THE CHRONICLES OF BUD MCGEE VIII.

A sudden string of time bending messages are sent from the future. Captain Bud McGee the Eighth is on a quest to unravel the mystery of his abduction and free a world, which is forced to battle at the hands of a highly evolved species. With the help of his alien friend, Three-Brain Elaine, a fellow captive with extraordinary intelligence, they hope to discover a path to freedom and bring down their captors...permanently! 

(This work is copyright protected and is intended for private, individual, and in-home use. Any public, not for profit use must contain the creator’s name and website: Samuel Petersen www.theearthstars.com.)
©2017

THE CHRONICLES OF BUD MCGEE VIII:

WRITTEN BY: SAMUEL PETERSEN

BEGIN TRANSMISSION-1

    My name is Captain Bud McGee the Eighth and I was born February 1st in the year 2121. I'm transmitting a series of warnings back in time. The designated target is AD 2017 (anno Domini-Gregorian calendar), via: "DEOXYRIBONUCLEIC ACID ENERGY MAPPING". This process of electronic time messaging was invented by Dr. Jasper Green in AD 2016. He discovered that significant events create an "energy burst stain" on certain individuals DNA. If that energy burst could be identified, you would be able to code a communiqué with the DNA sequence of that individual. Then your negatron laced announcement could be sent across space and time. Dr. Green was an astrophysicist at the University of Minnesota until his disappearance shortly after the discovery of "DNAEM". Unfortunately, these messages are not about the doctor and his disappearance.

    The reason I'm sending this back to AD 2017 is that several energy bursts occurred with one of my ancestors in that year. His DNA sequence was easily identifiable and readily available. With the assistance of a fellow prisoner, who belongs to the alien species called "Sānsesos", we are able to do this...she's actually the only reason we are able to do this. I lovingly refer to her as "Three-Brain Elaine"; her species have three separate brains in three separate heads, which funnel into one main nervous center receptor. That is where her eyes, ears, nose, and mouth are located...which, it essentially looks like our faces. I'll talk more about TBE (Three-Brain Elaine) later.  

    At the time I was taken to this new and unusual world, which I have been forced to fight in, I was serving in the Army Reserve's 704th Chemical Company. This unit was located in (what was formerly known as) Arden Hills, Minnesota and was the Reserve's first fully-certified hazardous material and chemical reconnaissance unit. Within 72 hours we were an effective, functioning response unit to stateside disasters, which included chemical spills, as well as biological, radiological, or nuclear attacks.   

    I do not have much time between caveat's as we are closely watched. I will do my best to chronicle the events which have forced me to take action. To do this properly, I need to go back to the beginning. My HOPE is to discover the conception of this hellish prison. Sometime shortly after AD 2016, a metaphorical stone was cast into the waters of time. This rippled into the beings which capture all other lifeforms and civilizations and then force us to fight. We call this planet...BATTLE-WORLD! I will describe this domain in greater detail as I send further communications.   

    Because it was discovered that these significant energy bursts are passed down from generation to generation, TBE is going to map my DNA and essentially read it like a book...a history book. As far as I know, by the year 2149, when I was 28, the same time I was abducted by these beings, actual human time travel did not exist; only time messages through DNAEM was plausible. Although it was discovered in AD 2016, the first actual messages were sent in AD 2020 as an experiment to warn humanity of a forthcoming invasion and attack on Earth Day in the year they were being sent from. The ability to send these messages were rare and closely monitored by a unified world alliance known as...Time Interval Gateway Enforcing Regiment (T.I.G.E.R).

    One thing I would like to mention before we begin the chronological discovery process...Three-Brain Elaine has tried to describe how this will work; however, it is slightly confusing to me. She has devised a machine which rapidly translates the information contained within my DNA into binary code (1's and 0's); the same as a computer. As it interprets that data, it is filtered back into me in the form of memories. At first, the process we are undergoing will set a base with my own memories and the history of the world I came from, which I am transmitting back to AD 2017. Once we reach my most recent memory, TBE has informed me, we will be able to then locate my ancestor's memories from AD 2016 and beyond. Part of the reason we are sending these messages to this specific time period is with the anticipation he might find them, read them, and then discover a way to possibly help shape our future. We really don't know if this is going to work?   

    OK...here we go...

    I grew up on a farm on the outskirts of a small Minnesota town. Although I grew up near Oakland, MN, that township had less than 500 people. Austin, MN was only a 10-minute drive. You may recognize that name as it is the base of operations for Hormel...which is where SPAM (the lunch meat) was invented. It is a town with a population nearing 25,000.

    My father, who was S. Buddy McGee the Seventh was a school teacher. My mother, Angelita McGee, unfortunately, passed away when I was two-years-old. She was in a car accident after coming home from work one night. She was a nurse at the Austin Medical Center, which was part of the Mayo Health Systems. Although I don't remember her, I was told she was a beautiful soul. Always willing to help others and her smile would brighten a room. Sadly, when I was 5, a fire at our home destroyed all of our possessions. I only have a few faint memories of the pictures and videos I saw of her. I wish I would have known her!

    My father had two, very dark years after the fire and times were rough for us. We had no other relatives and I was almost sent into foster care. Fortunately, he overcame his demons and when I was seven years old, we were on our way to a better life. The world itself was still in turmoil at that juncture. Land pollutions were reaching epic proportions. The massive Ocean Cleaning Enterprise Achieving Congruous Sustainability (O.C.E.A.N.S.) of AD 2032 was essentially undone. For some time, after the O.C.E.A.N.S project, the nations of the world came together. Regardless of socioeconomic status, political views, or any type of differences, every capable person volunteered at least two-years of their lives. Their efforts to restore, clean, and protect all bodies of water were epic an unprecedented. Families volunteered together as they lived and worked for the betterment of our earth.

ERROR1001010ACT011G0111001AT01C011110010A010001101010AA1010G00C0101100GCTACATAGTCA0TGTGTACGATACTGTACGTGACQTGTACG100011C010001A01011101101G101TAGCTG1AT1CG0TAGCTAGCTAGCTAGCTAGCATC1GATCGAT0CGACATCATCATGCTAG11CTAGTAGCTAC0110GATGATCGATCGA01010001110CT101010GAGACG1ATAA0TTAGTCGATG0011110ACTGAATGTGACGACACATA1CTATCAGTAG11101001111000110TACATCATGA01TGA1AERROR

Unf0rtunate1y, as with Any humaniTy level endeavor, the Good times bring about amnesia from the harsh ones. Sixty years of peaCe and prosperity ripened earthlings and sent the human race spiraling back down the path of destruction. Nearly irreversible acts set in motion a future of war, havoc, contamination, and vitiation.

By AD 2100 mass space travel was a reality. Governments had essentially collapsed and nations crumbled as borders disappeared. The wealthiest, most influential, and brightest among us conspired to leave our faltering planet. They secluded themselves to what was known as South Korea. North Korea, as a country, dissolved by AD 2088; however, their existing border protections were still intact. They used these as a defense while building their planetary exploration ships. In the year AD 2110, an independent country of roughly 36,000,000 citizens was declared. Their self-proclaimed land was called Rimoria, as they became knows as Rimorians. This was after the Latin word "Rimor", meaning an explorer. The rest of the world watched in horror as they methodically abandoned us.

Year after year, ship after ship; the hope of ever recovering our earth disappearing into an endless horizon. The planet pleaded with them to stay and fight for earth, rather than abandon it. They asked them to use their talents, ingenuity, money, prestige, expertise, and influence to save our world. They must have known something we did not, for tens of thousands gave way to hundreds of thousands. Eventually, hundreds of thousands led to millions deserting us to our own demise.

Halfway through my seventh year, which was AD 2128, two men were fighting for control of the earth. The last Rimorian ship was scheduled to depart in October of that year. The cries of the people had fallen on deaf ears as we gave up any belief they might stay.

My father was about to drive into town for a meeting when he pulled me aside and said, "There's something I want to tell you about our family when I get back tonight. It's a pretty cool secret that we share with our children when they get old enough."

"Can you tell me now...before you leave?" I asked him.

"I have a very important meeting to attend and I'm going to be late," he started to explain. "Pretty soon, everyone in the world is going to have to pick a side. The two men fighting for power are very different in how they view our earth. I still believe we can make this planet a sustainable, clean, and wonderful place to live. The man who believes this and who your daddy is supporting is actually flying here tonight. His name is Mr. Mboya and one of his ancestors was actually friends with one of our ancestors.

"That's so cool," I told him. "Can I go with you to meet him?"

We had been through a lot, and now it was just me and my father. He loved me very much and I loved him too.

"I wish I could take you," he said. "You will be safer here as there is going to be a lot happening tonight. Grown-ups are going to be discussing very important topics and there might be some yelling and arguing. The other contender, Mr. Poep, will be sending some of his people to the meeting. We hope we can come to an agreement on local water rights. I want you to be a big boy and wait for me to come home tonight. Can you do that?"

"Yes dad," I proudly proclaimed.

"That's my little soldier," he said while hugging me. "As soon as I get home tonight, I'll tell you that cool secret about our family;  deal."

"Deal!" I shouted.

I watched him get into that dusty little car and drive away. He honked at me and waved as he was turning onto the lonely gravel road. Although I was only seven...almost eight, I was pretty independent. I remember going inside, doing some dishes, and then cleaning a little bit around the house. I was excited for my dad to tell me about our cool family secret. Our relationship really improved after he got over the loss of his beloved wife. Once those dark years passed, he blossomed into an amazing father.   

He told me the meeting might run late, so after I was done cleaning I threw in a black market copy of an OLD NFL Super Bowl game. The league split in AD 2040 after several expansion teams inside and outside the United States went rogue and broke off; they became known as the NEW NFL. The OLD NFL battled the NEW NFL in the courts and on the field. Eventually, the division would be its ultimate demise...well, that and the great Pan-Asia Conflict (P.A.C) from AD 2042 until AD 2073 didn't help either. Asia was the largest continent and had over 4 billion people. Skirmishes, battles, and even wars lasted slightly over three decades.

Somehow, my family had passed down this banned broadcast of Super Bowl LII, which was played on February 4th, AD 2018. I watched as the former Minnesota Vikings won their first Super Bowl at US Bank stadium...it was the first time a home team had won the big game at their own stadium. The game was legendary in our family as it was our favorite team.

I remembered getting worried after watching the game. It was almost midnight and my dad hadn't come home yet. The September night was cold as I waited on the front steps for him to return. The farm was quiet that night. I decided to go back inside and grab some blankets and pillows. I wanted to sleep on the porch so I could hear him driving back home. The hours came and went, but I was diligent in my watch...until about 5am when I fell asleep.

Finally, around 7am I heard tires crunching on the gravel as they made their way to the house. I sat up and was about to scold my dad for being so late when I saw something that ran shivers down my spine. There was a sheriff's car parked in front of me instead of my dad's old junker. The deputy inside looked at me and swallowed. My eyes burned from behind as I knew something was wrong.

Getting out of the vehicle, he placed his hat in front of him and said, "Son, I'm sorry to tell you...but, your fathers been hurt."

"Is he at the hospital?" I asked with tears now streaming down my face.

"Son," he cleared his throat as he sat next to me, "I don't know how to tell you this, but your father died last night."

"NO!" I screamed.

"We are still investigating everything," he explained. "It appears the meeting he was at, got out of hand and someone there hurt him."

"Why would someone hurt my daddy?" I pleaded with him.

"I don't know kiddo," he attempted to reassure me, "but I promise you, we're gonna take care of ya."

I couldn't believe my father was murdered over a water rights dispute. That night I vowed ERRORGAGTC10010101TAGC0CTA1GGG0ACT100011TG11001A01C0101101AC110011C101CCTA1GG00ATTC1GTAATAGGC011ERROR

END TRANSMISSION-1